# NAME Geo::DNA - Encode latitude and longitude in a useful string format # SYNOPSIS use Geo::DNA qw( encode_geo_dna decode_geo_dna ); my $geo = encode_geo_dna( -41.288889, 174.777222, precision => 22 ); print "$geo\n" etctttagatagtgacagtcta my ( $lat, $lon ) = decode_geo_dna( $geo ); print "$lat | $lon\n"; -41.288889 | 174.777222 # VERSION 0.32 # FEATURES - Simple API Generally you just convert coordinates back and forth with simple function calls. - Fast It's just basic space partitioning, really. # DESCRIPTION NEW: see an interactive demo of Geo::DNA codes at http://www.shoffle.com/geodna-js/docs/google-maps.html This is a Perl version of the Python "geoprint" system that we developed a few years back at Action Without Borders. Its purpose is to encode a latitude/longitude pair in a string format that can be used in text databases to locate items by proximity. For example, if Wellington, New Zealand has the Geo::DNA(10) value of etctttagat (which it does), then you can chop characters off the end of that to expand the area around Wellington. You can easily tell if items are close together because (for the most part) their Geo::DNA will have the same prefix. For example, Palmerston North, New Zealand, has a Geo::DNA(10) code of etctttaatc which has the same initial 7 characters. The original implementation of this in Python was by Michel Pelletier. This uses a concept that is very similar to Gustavo Niemeyer's geohash system ( http://geohash.org ), but encodes the latitude and longitude in a way that is more conducive to stem-based searching (which is probably the a common use of these hashing systems). ## FUNCTIONS ### `encode_geo_dna` my $code = encode_geo_dna( latitude, longitude, options); Returns a Geo::DNA code (which is a string) for latitude, longitude. Possible options are: - radians => true/false A true value means the latitude and longitude are in radians. - precision => Integer (defaults to 22) number of characters in the Geo::DNA code. Note that any more than 22 chars and you're kinda splitting hairs. ### `decode_geo_dna` my ( $lat, $lon ) = decode_geo_dna( code, options ) Returns the latitude and longitude encoded within a Geo::DNA code. - radians => true/false If true, the values returned will be in radians. ### `neighbours_geo_dna` my $neighbours = neighbours_geo_dna( $code ); Returns an arrayref of the 8 Geo::DNA codes representing boxes of equal size around the one represented by $code. This is very useful for proximity searching, because you can generate these Geo::DNA codes, and then using only textual searching (eg. a SQL "LIKE" operator), you can locate any items within any of those boxes. The precision (ie. string length) of the Geo::DNA codes will be the same as $code. ### `bounding_box_geo_dna` my ( $lats, $lons ) = Geo::DNA::bounding_box_geo_dna( $code ); This returns an arrayref containing two arrayrefs: [ [ minimum latitude, maximum latitude ], [ minimum longitude, maximum longitude ], ] # TODO - Add conveniences to help you with prefix-based searching At present you have to understand how this geometry works fairly well in order to get the most out of this module. - Bulletproofing It's not particularly well-tested. And there is the boundary-problem in that two very close-by locations can have radically different Geo::DNA codes if they are on different sides of a partition. This is not a problem if you use the neighbouring Geo::DNA codes of your reference point to do proximity searching, but if you don't know how to do that, it will make life hard for you. # BUGS Please report bugs relevant to `GeoDNA` to . # CONTRIBUTING The github repository is at git://github.com/quile/geodna-perl.git. # SEE ALSO Some other stuff. # AUTHOR Kyle Dawkins, # COPYRIGHT AND LICENSE Copyright 2012 by Kyle Dawkins This library is free software; you can redistribute it and/or modify it under the same terms as Perl itself.